Journal: bioRxiv

Article Title: Chromatin remodeler BRG1 recruits huntingtin to repair DNA double-strand breaks in neurons

doi: 10.1101/2024.09.19.613927

Figure Lengend Snippet: (A) HTT immunocomplexes (ICs) analyzed by western blots (WBs) from nuclear protein extracts (NEs) isolated from 3-month-old wild-type C57BL/6 mouse brain. HTT was immunoprecipitated (IP’d) from NEs with an anti-HTT monoclonal antibody (Ab) (MAB2710, Millipore-Sigma). Immunocomplexes (ICs) tested for BRG1 and TC- NHEJ factors DNA-PKcs, Ku70, PNKP, XRCC4, LIG IV, POLR2A, CSB, and TFIIS in HTT ICs. Lane 1; protein molecular weight marker; lane 2: Input; lane 3: IgG control IP; lane 4: IP of HTT with anti-HTT Ab. (B) mHTT WBs IP’d from NEs isolated from 3-month-old HD homozygous zQ175 transgenic mouse brain with an anti-HTT Ab (MAB2710, Millipore-Sigma). mHTT ICs were analyzed by WBs for BRG1, and TC-NHEJ factors. Lane 1; protein molecular weight marker; lane 2: Input; lane 3: IgG control IP; lane 4: IP of HTT with an anti-HTT Ab. (C-G) Proximity ligation assay (PLA) for HTT and NHEJ factors in wild-type SH-SY5Y and in SH-SY5Y cells after treating the cells with DNA damaging agent etoposide (ET; 15µM, for 30 minutes). Generation of red fluorescence indicates representative positive protein-protein interactions. Nuclei stained with DAPI. (C) HTT interaction with Ku70 changes in response to increased DSBs. PLA was performed on SH-SY5Y cells with anti-HTT rabbit monoclonal Ab (5656; Cell Signaling) and anti-Ku70 mouse monoclonal Ab (SC-5309; Santa Cruz) before and after treating cells with ET (-ET and + ET respectively). (D) HTT and Ku70 relative interactions by PLA signals in control untreated (-ET) and ET- treated (+ ET) cells. Data represent mean ± SD, ****p<0.0001. (E) HTT interactions with XRCC4 in response to increased DSBs. PLA was performed with rabbit monoclonal anti-HTT Ab (5656; Cell Signaling) and anti-XRCC4 mouse monoclonal Ab (SC-271087; Santa Cruz) before and after treating the SH-SY5Y cells with ET (-ET and + ET respectively). (F) HTT and XRCC4 relative interactions assessed by relative PLA signals in control (- ET) cells and ET-treated (+ ET) cells. Data represent mean ± SD, ****p<0.0001. (G) HTT and PNKP interactions in response to increased DNA damage. PLA performed with anti-HTT mouse monoclonal Ab (MAB2170; Millipore-Sigma) and anti-PNKP rabbit polyclonal Ab (MBP-1-A7257; Novus) before and after treating SH-SY5Y cells with ET (-ET and + ET respectively). (H) HTT and PNKP interactions assessed by relative PLA signals in control (- ET) cells and ET-treated (+ ET) cells. Data represent mean ± SD, ****p<0.0001. (I) HTT association with genome. Chromatin immunoprecipitation (ChIP) performed to assess association/interaction of HTT with genome in untreated SH-SY5Y cells in a stress-free condition. After ChIP, DNA fragments purified from the cross-linked protein-DNA entities and the purified genomic DNA fragments analyzed by real-time quantitative PCR (qPCR). Relative ChIP values measured with respect to control IgG. Data represent mean ± SEM, ****p<0.0001. (J) DSBs measured by neutral comet analysis. SH-SY5Y cells were treated with DNA damaging agent bleomycin (BL; 5µg/mL, for 30 minutes), and subjected to neutral comet analysis to detect DSBs before (-BL) and after BL treatments (+ BL). Increased comet tail moments after BL treatments indicate presence of DSBs (shown with arrows; right panel). (K) HTT association with genome before and after inducing DSBs. SH-SY5Y cells treated with BL for 30 minutes to induce DSBs, and ChIP performed on control untreated cells and BL-treated cells. Relative ChIP values measured after normalization to control IgG. Data represent mean ± SEM, ****p<0.0001. ( L-P ) Sequential ChIP (ChIP-re-ChIP) analysis was performed to determine whether HTT and NHEJ factors co-occupy the same genomic DNA loci in vivo . (L) HTT-cross-linked genomic DNA. DNA fragments were isolated from the wildtype C57BL/6 mouse brain, and the DNA-protein complexes IP’d with an anti-HTT Ab (MAB2170; Millipore-Sigma), followed by a second immunoprecipitation (IP) of the HTT ICs with either an anti-Ku70 or an anti-IgG Abs. Genomic DNA fragments were isolated from the final Ku70 ICs and IgG ICs, and genomic DNA segments (∼250 bp) encompassing Neurod1 (ND1) or Tubulin Beta 3 Class III (Tubb3) genomic regions were amplified by quantitative PCR (qPCR) using specific primers and PCR products were quantified by qPCR. Relative ChIP values were measured after normalization to control IgG. Data represent mean ± SEM, ****p<0.0001. (M) Ku70-bound genomic DNA. DNA fragments were IP’d with an anti-Ku70 Ab (SC- 5309; Santa Cruz), followed by a second IP of the Ku70 ICs with an anti-HTT (MAB2170; Millipore-Sigma) or an anti-IgG Abs. DNA isolated from the final HTT ICs and IgG ICs, and genomic DNA segments (∼250 bp) encompassing Neurod1 or Tubb3 genes was amplified using specific primers and the PCR products quantified. Relative ChIP values were measured after normalization to control IgG. Data represent mean ± SEM, ****p<0.0001. (N) HTT-DNA complexes from anti-HTT and anti-XRCC4 Abs. Putative HTT-DNA complexes were IP’d with an anti-HTT Ab (MAB2170; Millipore-Sigma), followed by a second IP of the HTT ICs with either an anti-XRCC4 (SC-271087; Santa Cruz) or an anti-IgG Abs. The DNA fragments were isolated from XRCC4 ICs and IgG ICs, and genomic DNA segments (∼250 bp) encompassing Neurod1 or Tubb3 genes amplified, and PCR products analyzed by qPCR. Relative ChIP values measured after normalization to IgG. Data represent mean ± SEM, ****p<0.0001. (O) HTT-DNA complexes from anti-HTT and anti-DNA ligase IV Abs. Putative HTT- DNA complexes were IP’d with an anti-HTT Ab (MAB2170; Millipore-Sigma), followed by a second IP of the HTT ICs with either an anti-DNA ligase IV (14649; Cell Signaling) or an anti-IgG Abs. DNA isolated from the ligase IV ICs and IgG ICs, and genomic DNA segments encompassing Neurod1 or Tubb3 genes were amplified by qPCR and the PCR products analyzed. Relative ChIP values measured after normalization to control IgG. Data represent mean ± SEM, ****p<0.0001. (P) HTT-DNA complexes from anti-HTT and anti-PNKP Abs Putative HTT-bound DNA fragments were IP’d with an anti-HTT Ab (MAB2170; Millipore-Sigma), followed by a second IP of the HTT ICs with either an anti-PNKP Ab (MBP-1-A7257; Novus) or an anti-IgG Abs. DNA isolated from PNKP ICs and IgG ICs, and genomic segments (∼250 bp) encompassing Neurod1 or Tubb3 genes were amplified using specific primers and the PCR products quantified. Relative ChIP values measured after normalization to control IgG. Data represent mean ± SEM, ****p<0.0001.

Article Snippet: Plasmid encoding human DNA ligase IV was purchased from Origene (USA) and the ligase IV cDNA was PCR-amplified with appropriate primers and was subcloned into plasmid pCMV-Myc-N (Takara Bio).

Techniques: Western Blot, Isolation, Immunoprecipitation, Molecular Weight, Marker, Control, Transgenic Assay, Proximity Ligation Assay, Fluorescence, Staining, Chromatin Immunoprecipitation, Purification, Real-time Polymerase Chain Reaction, ChIP-chip, In Vivo, Amplification

Journal: bioRxiv

Article Title: Chromatin remodeler BRG1 recruits huntingtin to repair DNA double-strand breaks in neurons

doi: 10.1101/2024.09.19.613927

Figure Lengend Snippet: (A) NEs isolated from SH-SY5Y cells constitutively expressing FLAG-tagged BRG1, and the exogenous FLAG-tagged BRG1 IP’d from the NEs with anti-FLAG Ab (F3165; Millipore-Sigma) and the FLAG IC analyzed by western blotting to detect HTT, and the key NHEJ proteins in the FLAG ICs. Lane 1: protein molecular weight marker; lane 2: Input; lane 3 IgG IP; lane 4: FLAG IP and lane 5: total cell extract (Total CE). The IgG heavy chain (IgG-HC) in the XRCC4 WB shown by arrow. (B) NEs isolated from SH-SY5Y cells constitutively expressing exogenous FLAG-tagged wtHTT carrying 19 glutamines (FLAG-wtHTT-Q19), and the exogenous FLAG- wtHTT-Q19 IP’d from the NEs with anti-FLAG Ab (F3165; Millipore-Sigma), and the FLAG ICs analyzed by western blotting to detect key NHEJ proteins in the FLAG ICs. Lane 1: protein molecular weight marker; lane 2: Input; lane 3 IgG IP; lane 4: FLAG IP and lane 5: total cell extract (Total CE). (C) Proximity ligation assay (PLA) performed to assess possible interaction of BRG1 and NHEJ proteins in SH-SY5Y cells. Generation of green fluorescence indicates representative positive protein-protein interactions. Nuclei stained with DAPI. PLA with anti-BRG1 (mouse) Ab and various NHEJ components e.g., Ku80 (Panel 1), Ku70 (Panel 2), PARP1 (Panel 3), XRCC4 (Panel 4), DNA ligase IV (Panel 5), DNA-PKcs (Panel 6), were performed before and after treating SH-SY5Y cells with ET.

Article Snippet: Plasmid encoding human DNA ligase IV was purchased from Origene (USA) and the ligase IV cDNA was PCR-amplified with appropriate primers and was subcloned into plasmid pCMV-Myc-N (Takara Bio).

Techniques: Isolation, Expressing, Western Blot, Molecular Weight, Marker, Proximity Ligation Assay, Fluorescence, Staining

Journal: bioRxiv

Article Title: Chromatin remodeler BRG1 recruits huntingtin to repair DNA double-strand breaks in neurons

doi: 10.1101/2024.09.19.613927

Figure Lengend Snippet: (A) Experimental HTT association with Ku70, Ku80, PNKP, and XRCC4. Total proteins were extracted from control SH-SY5Y cells (Cntl; lane 2), SH-SY5Y cells either expressing HTT-RNAi (HTT-KD cells; lane 3) or full-length human wtHTT cDNA (HTT-OE cells; lane 4). Protein extracts were analyzed by WBs to detect HTT, Ku70, Ku80, PNKP, and XRCC4 levels; β-actin was used as loading control. Lane 1: Protein molecular weight marker in kDa. (B) HTT-depletion increases double strand break (DSB) foci. HTT-knocked down (HTT- KD) SH-SY5Y cells (upper panels) and control wildtype untreated SH-SY5Y cells (lower panels) were analyzed by immunostaining with an anti-53BP1 Ab (4937; Cell Signaling) to measure DSBs in the nuclei. The 53BP1-positive DSBs in genomic DNA (red puncta) within the nuclei (blue) of HTT-KD cells (upper panel) shown by arrows. Similar discrete nuclear puncta not detected in control cell nuclei (Lower panel). Nuclei stained with DAPI (blue). (C) HTT-depletion increases measured genomic DNA damage. Genomic DNA isolated from control SH-SY5Y cells (Cntl; lanes 1 to 3), SH-SY5Y cells expressing HTT- RNAi (HTT-KD cells; lanes 4 to 6) or SH-SY5Y cells overexpressing full-length wtHTT (HTT-OE cells; lanes 7 to 9), and presence of DNA damage/lesions in the genome were assessed by LA-QPCR analyses. Genomic DNA segments (8 to 10 kb segments) from various genome regions encompassing the NEUROD1, NEUROG1, BDNF, BCL2L2, or ENOLASE gamma (ENOγ) genes PCR were amplified using specific primers, and the PCR products analyzed on agarose gel, and intensity of the DNA bands quantified. LA denotes long amplicon (8.0 to 9.0 kb); SA denotes short amplicon (0.2 to 0.3 kb); Lane 10: 1-kb DNA ladder. (D) HTT-depletion significantly increases DNA damage in multiple genomic regions. Relative levels of DNA damage in various genomic DNA regions encompassing the NEUROD1, NEUROG1, BDNF, BCL2L2, or ENOγ genes quantified in control cells (Cntl), and cells expressing HTT-RNAi (HTT-KD) or full-length HTT-cDNA (HTT- OE). Data represents Mean ± SD. ***p<0.001; ****p<0.0001. (E) HTT-depletion increases chromosome aberrations from ionizing radiation. Control SH- SY5Y cells and HTT-deficient SH-SY5Y cells (expressing two independent shRNA; HTT-shRNA-1 and HTT-shRNA-2) were exposed to ionization radiation (2 Gray units) and chromosome aberration at metaphase scored before and after irradiation from three independent experiments. For each experiment chromosome aberrations from 100 metaphases scored. (Mean ± SD. ***p<0.001; ****p<0.0001). (F) HTT PolyQ length and chromosome aberrations from ionizing radiation. Control wildtype SH-SY5Y cells (SH-SY5Y-1 and SH-SY5Y-2 cells) and SH-SY5Y cells overexpressing exogenous FLAG-tagged wtHTT encoding 19, 20 or 24 glutamines (SH-SY5Y-HTT-Q19, SH-SY5Y-HTT-Q20, and SH-SY5Y-Q24) were exposed to ionization radiation (2 Gray units) and chromosome aberration at metaphase scored before and after irradiation from three independent experiments. For each experiment chromosome aberrations from 100 metaphases scored. (Mean ± SD. **p<0.01); ns denotes not significant.

Article Snippet: Plasmid encoding human DNA ligase IV was purchased from Origene (USA) and the ligase IV cDNA was PCR-amplified with appropriate primers and was subcloned into plasmid pCMV-Myc-N (Takara Bio).

Techniques: Control, Expressing, Molecular Weight, Marker, Immunostaining, Staining, Isolation, Amplification, Agarose Gel Electrophoresis, shRNA, Irradiation

Journal: bioRxiv

Article Title: Chromatin remodeler BRG1 recruits huntingtin to repair DNA double-strand breaks in neurons

doi: 10.1101/2024.09.19.613927

Figure Lengend Snippet: (A) Ligation-mediated PCR analysis at indicated time points after the addition of CRISPR- CAS9 gRNA containing liposomes measured the proportion of uncut DNA at two different sites of chromosome 17 (Chromosome 17: Chr17A and Chromosome 17B; Chr17B). (Mean ± SD. ****p<0.0001). (B) SH-SY5Y cells treated with either empty liposomes (Left panel) or liposomes carrying CRISPR-CAS9 gRNA (Central and right panels) for 45 or 135 minutes and cells analyzed by immunostaining with anti-γ-H2AX Ab. The γ-H2AX-positive nuclear foci shown by arrows. Nuclei stained with DAPI. (C) Low recruitment of NHEJ proteins in HTT-KD SH-SY5Y cells. DSBs were induced at specific locus of chromosome 17 (Chr17A) of control SH-SY5Y and HTT-KD SH- SY5Y cells using liposome-mediated delivery of CRISPR-CAS9 gRNA. Cells were harvested 135 minutes after adding liposomes, and ChIP performed to assess the relative recruitment of NHEJ proteins e.g., Ku70, Ku80, 53BP1, PNKP and DNA ligase IV at the DSB site in control and HTT-KD SH-SY5Y cells. Data represent Mean ± SD. **p<0.005; ***p<0.001; ****p<0.0001; and ns denotes not significant. (D) HTT depletion reduces DSB repair response to bleomycin. Control SH-SY5Y cells (Cntl; lanes 1 to 3), SH-SY5Y cells expressing HTT-RNAi (HTT-KD cells; lanes 4 to 6) and expressing the full-length human wtHTT-Q19 cDNA (HTT-OE cells; lanes 7 to 9) treated with bleomycin (BL; 5µg/mL; lanes 2, 3, 5, 6, 8 and 9) for 30 minutes. Cells were introduced with fresh medium to allow repair of the DSBs for 10’, cells harvested after 10 minutes of repair (R-10’; lanes 3, 6 and 9), DNA were isolated from each cell pellet, and various genomic DNA loci (10 kb or 0.2 kb genome segments encompassing NEUROD1 and BDNF genes) PCR amplified, and PCR products analyzed on agarose gels to determine relative PCR amplification efficacies. LA and SA denote long and short amplicon respectively. Lane 10: 1-kb DNA ladder. (E) HTT expression level correlates DSB repair. Relative levels of DNA damage in control SH-SY5Y cells (Cntl), HTT-KD cells, and HTT-OE cells, after treating the cells with BL (300 ng/mL) for 30 minutes, and 10 minutes after BL removal from the culture medium for allowing repair of the lesions (Recovery-10’); data represent means ± SD, *p<0.05; **p<0.005; ***p<0.001; ****p<0.0001; NS denotes not significant.

Article Snippet: Plasmid encoding human DNA ligase IV was purchased from Origene (USA) and the ligase IV cDNA was PCR-amplified with appropriate primers and was subcloned into plasmid pCMV-Myc-N (Takara Bio).

Techniques: Ligation, CRISPR, Liposomes, Immunostaining, Staining, Control, Expressing, Isolation, Amplification

Journal: bioRxiv

Article Title: Chromatin remodeler BRG1 recruits huntingtin to repair DNA double-strand breaks in neurons

doi: 10.1101/2024.09.19.613927

Figure Lengend Snippet: (A) NEs isolated from control SH-SY5Y cells (Cntl; lane 2), expressing human BRG1 cDNA (BRG1-OE; lane 3), expressing BRG1-RNAi (BRG1-KD; lane 4), NEs analyzed by WBs to detect BRG1, HTT and NHEJ protein levels; β-actin used as loading control. Lane 1: Protein molecular weight marker in kDa. (B) BRG1-KD SH-SY5Y cells (upper panel) analyzed by immunostaining with anti-53BP1 Ab (Cat # 2675; Cell Signaling) to detect the presence of DSBs (arrows). Nuclei stained with DAPI (blue). Control SH-SY5Y cells (lower panel) analyzed by immunostaining the cells with anti-53BP1 Ab (Cat # 2675; Cell Signaling) to detect the presence of DSBs in nuclei. Nuclei stained with DAPI (Blue). (C) Genomic DNAs isolated from the control SH-SY5Y cells (Cntl; lanes 1 to 3), SH- SY5Y cells expressing BRG1-RNAi (BRG1-KD; BRG1-knocked-down cells; lanes 4 to 6) or cells expressing human BRG1 cDNA (BRG1-OE cells; lanes 7 to 9), and DNA damage assessed by LA-QPCR. ∼8 to 10 kb regions of genome encompassing NEUROD1, BCL2L2, or BDNF) PCR-amplified, and the PCR products quantified. LA denotes long amplicon (8 to 10 kb); SA denotes short amplicon (0.2 to 0.3 kb); Lane 10: 1-kb DNA ladder. (D) Relative DNA damage in various genomic loci (NEUROD1, BCL2L2, or BDNF) quantified in control cells (Cntl), and cells expressing BRG1-RNAi (BRG1-KD) or human BRG1 cDNA (BRG1-OE). Data represents Mean ± SD. ****p<0.0001. (E) DSBs induced at transcriptionally active locus of chromosome 1 (Chr-1A) and transcriptionally inactive locus (Chr-1B) in control SH-SY5Y cells and BRG1-KD SH- SY5Y cells, cell harvested 135 minutes after adding liposomes, and ChIP performed to assess recruitment of HTT at the DSB sites in BRG1-KD and control SH-SY5Y cells. Data represents mean ± SD. ****p<0.0001; ns= not significant. (F) DSBs induced at transcriptionally active locus of chromosome 1 (Chr-1A) and transcriptionally inactive locus (Chr-1B) in control and HTT-KD SH-SY5Y cells, cell harvested 135 minutes after adding liposomes, and ChIP performed to assess the relative recruitment of BRG1 at the DSB site in HTT-KD and control SH-SY5Y cells. Data represents mean ± SD; ns= not significant.

Article Snippet: Plasmid encoding human DNA ligase IV was purchased from Origene (USA) and the ligase IV cDNA was PCR-amplified with appropriate primers and was subcloned into plasmid pCMV-Myc-N (Takara Bio).

Techniques: Isolation, Control, Expressing, Molecular Weight, Marker, Immunostaining, Staining, Amplification, Liposomes

Journal: bioRxiv

Article Title: Chromatin remodeler BRG1 recruits huntingtin to repair DNA double-strand breaks in neurons

doi: 10.1101/2024.09.19.613927

Figure Lengend Snippet: (A) Association of HTT with transcriptionally active DSB regions. DSBs were introduced within the transcriptionally active gene-rich locus (locus A) and in transcriptionally inactive gene-poor locus (locus B) in chromosome 1 and 17 (Chr-1 and Chr-17 respectively) in cells with and without induction of I-SceI restriction enzyme. Induced DSBs and relative occupancy/recruitment of HTT at the DSB sites within the transcriptionally active and in transcriptionally inactive chromosomal regions before and after inducing DSBs were determined by ChIP analysis. Data represent Mean ± SD. **p<0.005; ****p<0.0001; ns= not significant. (B) RNA polymerase II (POLR2A) levels at the DSB sites before and after CRISPR-CAS9 gRNA-mediated induction of DSB at Chr17A locus in SH-SY5Y cells with and without HTT-shRNA-mediated depletion of HTT. Mean ± SD. ***p<0.001. (C) RNA polymerase II (POLR2A) levels at the DSB sites before and after I-Scel induced DSBs at Chromosome 1 at transcriptionally active locus (Chr-1A) as well as in transcriptionally inactive locus (Chr-1B) were measured in cells with and without depletion of HTT. Data represent Mean ± SD. ***p<0.001. NS= not significant. (D) Robust recruitment of NHEJ factors in STHdhQ7 but not in mutant STHdhQ111 cells. STHdhQ7 and mutant STHdhQ111 cells were tested by liposome-mediated delivery of CRISPR-CAS12 gRNA, cells harvested 135 minutes after adding liposomes, and ChIP performed to assess relative recruitment of NHEJ proteins e.g., PNKP, Ku70, and DNA ligase IV at the DSB site in mutant STHdhQ111 and wildtype STHdhQ7 cells. Data represent Mean ± SD. **p<0.005; ***p<0.001; ****p<0.0001; ns= not significant. (E) DSBs persist in mutant STHdhQ111 cells but not in control STHdhQ7 cells. Mutant STHdhQ111 cells (left panel) and control STHdhQ7 cells (right panel) were analyzed by immunostaining with an anti-p-53BP1Ab (2675; Cell Signaling) to detect the presence of double strand breaks (DSBs) in nuclear genome. The p-53BP1-positive DSBs in genomic DNA (green puncta) within the nuclei (blue) of STHdhQ111 cells (left panel) are shown by arrows. Similar nuclear puncta not detected in control cell nuclei (right panel). Nuclei stained with DAPI (blue). (F) Relative amounts of 53BP1-positive puncta indicating DNA damage in mutant STHdhQ111 cells is high compared with control STHdhQ7 cells. Data represent means ± SD, ****p<0.0001. (G) Lower metaphase aberrations in wildtype STHdhQ7 compared to mutant STHdhQ111 cells. Wildtype STHdhQ7 and mutant STHdhQ111 cells in plateau phase were irradiated with 3 Gy, incubated for 18 hours post-irradiation, and G1-type aberrations examined at metaphase. Categories of asymmetric chromosome aberrations scored included dicentrics, centric rings, interstitial deletions-acentric rings, and terminal deletions. The frequency of chromosomal aberrations in STHdhQ111 cells after IR exposure were compared with control cells. Data represent means ± SD, ****p<0.0001). (H) Similar exponential phase aberrations in wildtype STHdhQ7 compared to mutant STHdhQ111 cells. Wildtype STHdhQ7 and mutant STHdhQ111 cells in exponential phase were exposed to 2 Gy IR, and metaphases harvested 3 hours post-irradiation and examined for chromosomal aberrations. The difference between chromatid and chromosomal aberrations induced by IR is not significantly higher in STHdhQ111 cells compared to control cells. ns= not significant. (I) Wildtype STHdhQ7 and mutant STHdhQ111 cells in exponential phase were irradiated with 1 Gy IR. Metaphases were harvested after 1-hour post-irradiation and analyzed for chromosomal aberrations. The differences in chromosomal aberrations between samples treated with IR are not statistically significant between STHdhQ111 and STHdhQ7 cells. Data represent means ± SD, **p<0.005. (J) Chromosome aberrations measured in control cells, HTT-depleted cells and HTT and BRG1 depleted cells before (0 Gy) and after irradiating the cells with IR (3 Gy). Data represent means ± SD, ****p<0.0001. ns = not significant.

Article Snippet: Plasmid encoding human DNA ligase IV was purchased from Origene (USA) and the ligase IV cDNA was PCR-amplified with appropriate primers and was subcloned into plasmid pCMV-Myc-N (Takara Bio).

Techniques: CRISPR, shRNA, Mutagenesis, Liposomes, Control, Immunostaining, Staining, Irradiation, Incubation

Journal: bioRxiv

Article Title: Chromatin remodeler BRG1 recruits huntingtin to repair DNA double-strand breaks in neurons

doi: 10.1101/2024.09.19.613927

Figure Lengend Snippet: (A) Table of genes identified in RNAseq analysis that have P values of less than 0.001 when Drosophila expressing mHTT (UAS-128Qhtt FL ) were compared to WT control. The table depicts the genes sorted by increasing P value of difference when Drosophila expressing mHTT (UAS-128Qhtt FL ) were compared to WT control with P < 0.0001 noted by **** and P < 0.0001 noted by ***. The color of each table cell is based on the variance value of detected RNA level for that gene (row) and mutant (column) compared to WT control with white as no change, green as increased levels, and red as decreased levels. The deeper the color the more the variance from the WT control levels. The variance value is also included in each cell. (B) The table depicts the weighted difference of the level of the co-overexpression compared to mHTT only expression. The color of each table cell is based on the weighted variance value of difference to WT level for that gene (row) and mutant (column) compared to mHTT only expression, with white as similar difference to WT control levels, green as more like WT control levels, and red as less as the WT control levels. The deeper the color the greater the difference in variance to mHTT only expression compared to the WT control levels. The weighted variance value is also included in each cell, and again higher value means closer to WT mRNA level. If the expression level compared to WT level flipped from greater than WT level to less than WT level or vice versa compared to mHTT expression the cell border is bolded. (C) Proposed schematic mechanisms whereby wild-type HTT (wtHTT) stimulates DNA repair to maintain genome integrity and how mutant HTT (mHTT) synchronously disrupts DNA repair and transcription in HD to trigger early neurotoxicity in HD. wtHTT and BRG1 assemble a DSB repair complex with essential NHEJ factors including PNKP, Ku70, Ku80, DNA-PKcs, XRCC4, DNA ligase IV, CSB and PNKP in neurons. This structure senses DSBs during transcription and orchestrates their repair. wtHTT thus plays a pivotal role in DNA repair and in maintaining genome integrity during transcription. In contrast, HTT polyQ expansions inhibit recruitment of various NHEJ factors at the DSB sites, degrading normal TC- NHEJ function and DSB repair. This leads to persistence of DSBs in genome and chronic activation of the DNA-damage-response in HD. Cumulative accumulation of DSBs within transcriptionally active genome adversely impacts expression of neuronal genes, amplifying pro-degenerative impacts. Mutant HTT thus synchronously impairs DNA repair and transcription, triggering neurotoxicity and functional decline in HD.

Article Snippet: Plasmid encoding human DNA ligase IV was purchased from Origene (USA) and the ligase IV cDNA was PCR-amplified with appropriate primers and was subcloned into plasmid pCMV-Myc-N (Takara Bio).

Techniques: Expressing, Control, Mutagenesis, Over Expression, Activation Assay, Functional Assay

Journal: Oncotarget

Article Title: LINE-1 hypomethylation in normal colon mucosa is associated with poor survival in Chinese patients with sporadic colon cancer

doi:

Figure Lengend Snippet: Bisulfite-treated DNA samples from adjacent normal mucosa were subjected to PCR amplification and were quantitatively analyzed by pyrosequencing. The C base marked in yellow served as a quality control of the bisulfite conversion efficiency. Four analyzed CpG sites are highlighted in blue, and the percent methylation rate is provided for each site. The mean percentage was computed as the LINE-1 methylation rate (LMR) for each case. Two cases with relatively higher (73.8%, A. ) or lower (19.4%, B. ) LMR were shown, respectively.

Article Snippet: In this system, a bisulfite-converted universal human DNA standard of 100% methylation (#D5015, ZYMO Research, USA) and ALU-C4 were used as the reference template and internal control, respectively.

Techniques: Amplification, Methylation

Journal: American Journal of Physiology - Cell Physiology

Article Title: miR-222 represses expression of zipcode binding protein-1 and phospholipase C-γ1 in intestinal epithelial cells

doi: 10.1152/ajpcell.00165.2018

Figure Lengend Snippet: Interaction of microRNA-222 (miR-222) with the zipcode binding protein-1 (ZBP1) and phospholipase C-γ1 (PLCγ1) mRNAs. A: miR-222 and U6 RNA levels in HCT-116 cells transfected with biotinylated miR-222 for 24 h. Values are means ± SE from 3 independent experiments (n = 4). *P < 0.01 compared with cells transfected with control scramble oligomer as analyzed by one-way ANOVA followed by Duncan’s test. B: levels of ZBP1, PLCγ1, claudin-1 (CCND1), and FZD7 mRNAs in the materials pulled down by biotin-miR-222 (left) and total input mRNAs (right) in cells described in A. Fzd7 served as a positive control.

Article Snippet: Human ZBP1 and PLCγ1 cDNAs and siRNAs were purchased from OriGene Technologies (Rockville, MD).

Techniques: Binding Assay, Transfection, Positive Control

Journal: American Journal of Physiology - Cell Physiology

Article Title: miR-222 represses expression of zipcode binding protein-1 and phospholipase C-γ1 in intestinal epithelial cells

doi: 10.1152/ajpcell.00165.2018

Figure Lengend Snippet: Ectopically expressed microRNA-222 (miR-222) represses the expression of zipcode binding protein-1 (ZBP1) and phospholipase C-γ1 (PLCγ1). A: levels of miR-222 and U6 RNA 48 h after transfection with pre-miR-222 as measured by quantitative PCR analysis. Values are means ± SE from independent experiments (n = 4). *P < 0.05, compared with cells transfected with control scrambled oligomer analyzed by one-way ANOVA followed by Duncan’s test. B: immunoblots of ZBP1, PLCγ1, and PCNA proteins in HCT-116 cells described in A. Whole cell lysates were harvested and prepared for Western blotting; equal loading was monitored by assessing GAPDH levels. C: quantitative analysis of ZBP1 and PLCγ1 immunoblotting signals as measured by densitometry using Bio-Rad-XRS system equipped with Image laboratory software (version 4.1) and used “Quantity tool” to determine the band intensity volume. The values were normalized with internal loading control GAPDH. Values are means ± SE of data from 3 independent experiments (n = 3). D and E: changes in ZBP1, PLCγ1, and PCNA proteins in IEC-Cdx2L1 cells 48 h after transfection with pre-miR-222. Values are means ± SE (n = 3). Statistical test: means are compared with the scramble (cells exposed to pre-miR-222) by nonparametric comparison (*P < 0.0495, Kruskal-Wallis test).

Article Snippet: Human ZBP1 and PLCγ1 cDNAs and siRNAs were purchased from OriGene Technologies (Rockville, MD).

Techniques: Expressing, Binding Assay, Transfection, Real-time Polymerase Chain Reaction, Western Blot, Software

Journal: American Journal of Physiology - Cell Physiology

Article Title: miR-222 represses expression of zipcode binding protein-1 and phospholipase C-γ1 in intestinal epithelial cells

doi: 10.1152/ajpcell.00165.2018

Figure Lengend Snippet: microRNA-222 (miR-222) overexpression destabilizes the zipcode binding protein-1 (ZBP1) and phospholipase C-γ1 (PLCγ1) mRNAs. A: levels of the ZBP1 and PLCγ1 mRNAs in cells transfected with pre-miR-222 for 48 h. JunD served as a negative control. Values are the means ± SE from independent experiments (n = 3). *P < 0.01, compared with cells transfected with control scramble oligomer as analyzed by one-way ANOVA followed by Duncan’s test. B–D: half-lives of the ZBP1, PLCγ1, and GAPDH mRNA in cells described in A. Total cellular RNA was isolated at indicated times after administration of actinomycin D (5 μg/ml), and the levels of ZBP1, PLCγ1, and GAPDH mRNAs were measured by quantitative PCR analysis. GAPDH mRNA served as a control. *P < 0.05, compared with cells transfected with C-oligo as analyzed by one-way ANOVA followed by Duncan’s test.

Article Snippet: Human ZBP1 and PLCγ1 cDNAs and siRNAs were purchased from OriGene Technologies (Rockville, MD).

Techniques: Over Expression, Binding Assay, Transfection, Negative Control, Isolation, Real-time Polymerase Chain Reaction

Journal: American Journal of Physiology - Cell Physiology

Article Title: miR-222 represses expression of zipcode binding protein-1 and phospholipase C-γ1 in intestinal epithelial cells

doi: 10.1152/ajpcell.00165.2018

Figure Lengend Snippet: microRNA-222 (miR-222) silencing enhances the expression of zipcode binding protein-1 (ZBP1) and phospholipase C-γ1 (PLCγ1). A: levels of miR-222 and U6 RNA 48 h after transfection with anti-miR-222. Values are the means ± SE from 3 independent experiments (n = 4). *P < 0.05, compared with cells transfected with control oligomer (C-oligo). B: immunoblots of ZBP1, PLCγ, and PCNA proteins in cells described in A. C: quantitative analysis of ZBP1 and PLCγ1 immunoblotting signals by densitometry using Bio-Rad-XRS system equipped with Image laboratory software (version 4.1) and used “Quantity tool” to determine the band intensity volume. The values were normalized with internal loading control GAPDH. Values are means ± SE of data from 3 independent experiments (n = 3). Statistical test: means are compared with the scramble (cells exposed to Anti-miR-222) by nonparametric comparison (*P < 0.0495, Kruskal-Wallis test).

Article Snippet: Human ZBP1 and PLCγ1 cDNAs and siRNAs were purchased from OriGene Technologies (Rockville, MD).

Techniques: Expressing, Binding Assay, Transfection, Western Blot, Software

Journal: American Journal of Physiology - Cell Physiology

Article Title: miR-222 represses expression of zipcode binding protein-1 and phospholipase C-γ1 in intestinal epithelial cells

doi: 10.1152/ajpcell.00165.2018

Figure Lengend Snippet: microRNA-222 (miR-222) silencing increases the stability of the zipcode binding protein-1 (ZBP1) and phospholipase C-γ1 (PLCγ1) mRNAs. A: levels of the ZBP1 and PLCγ1 mRNAs in cells transfected with anti-miR-222 for 48 h. JunD served as a negative control. Values are the means ± SE from independent experiments (n = 4). *P < 0.01, compared with cells transfected with C-oligo. B–D: half-lives of the ZBP1, PLCγ1, and GAPDH mRNA in cells described in A. Total cellular RNA was isolated at indicated times after administration of actinomycin D (5 μg/ml), and the levels of ZBP1, PLCγ1, and GAPDH mRNAs were measured by quantitative PCR analysis. GAPDH mRNA served as a control. *P < 0.05, compared with cells transfected with C-oligo as analyzed by one-way ANOVA followed by Duncan’s test.

Article Snippet: Human ZBP1 and PLCγ1 cDNAs and siRNAs were purchased from OriGene Technologies (Rockville, MD).

Techniques: Binding Assay, Transfection, Negative Control, Isolation, Real-time Polymerase Chain Reaction

Journal: American Journal of Physiology - Cell Physiology

Article Title: miR-222 represses expression of zipcode binding protein-1 and phospholipase C-γ1 in intestinal epithelial cells

doi: 10.1152/ajpcell.00165.2018

Figure Lengend Snippet: microRNA-222 (miR-222)-regulated expression of zipcode binding protein-1 (ZBP1) and phospholipase C-γ1 (PLCγ1) modulates rapid epithelial restitution after wounding. A: images of cell migration: a, 0 h after wounding in control cells (Con-0 h); b, 6 h after wounding in control cells (Con-6 h); c, 6 h after wounding in cells transfected with scramble oligo (C-oligo-6 h); d, 6 h after wounding in cells transfected with pre-miR-222 alone for 48 h (Pre-miR-222–6 h); e, 6 h after wounding in cells cotransfected with pre-miR-222 and the expression vector encoding ZBP1 (Pre-miR222 + ZBP1); f, 6 h after wounding in cells cotransfected with pre-miR-222 and the expression vector encoding PLCγ1 (Pre-miR222+ PLCγ1). Scale bar, 100 μm; magnification, ×100. B: summarized data showing rates of cell migration 6 h after wounding in cells described in A. Values are the means ± SE of data from 6 dishes and repeated 4 times independently (n = 4). *,+P < 0.05, compared with cells transfected with scramble and cells transfected with pre-miR-222, respectively as analyzed by one-way ANOVA followed by Duncan’s test. C: images of cell migration: a: 0 h after wounding in control cells; b: 6 h after wounding in control cells; c, 6 h after wounding in cells transfected with scramble oligo; d: 6 h after wounding in cells transfected with anti-miR-222 alone for 48 h; e: 6 h after wounding in cells cotransfected with anti-miR-222 and siZBP1 (Anti-miR222 + siZBP1); f: 6 h after wounding in cells cotransfected with anti-miR-222 and siPLCγ1 (Anti-miR222 + siPLCγ1); and g: 6 h after wounding in cells cotransfected with anti-miR-222, siZBP1 and siPLCγ1 (anti-miR222 + siZBP1 + siPLCγ1). Scale bar, 100 μm; magnification, ×100. D: summarized data showing rates of cell migration in cells described in C. Values are the means ± SE of data from 6 dishes and repeated four times independently (n = 4). *,+P < 0.05, compared with cells transfected with scramble and cells transfected with Anti-miR-222, respectively as analyzed by one-way ANOVA followed by Duncan’s test. E: immunoblot of PCNA protein in nonwounding and 0 h and 6 h after wounding (#1 and #2). Whole cell lysates were harvested and prepared for Western blotting; equal loading was monitored by assessing GAPDH levels.

Article Snippet: Human ZBP1 and PLCγ1 cDNAs and siRNAs were purchased from OriGene Technologies (Rockville, MD).

Techniques: Expressing, Binding Assay, Migration, Transfection, Plasmid Preparation, Western Blot

Journal: Scientific Reports

Article Title: New Insights into Cooperative Binding of Homeodomain Transcription Factors PREP1 and PBX1 to DNA

doi: 10.1038/srep40665

Figure Lengend Snippet: Panel A: Homeodomain (HD) protein constructs used for characterizations described in this study, in comparison with full-length proteins. PBX1 HD and HOXB1 HD constructs are the same used in the X-ray crystallographic study . PREP1 HD is present in four lengths, PREP1 257-325 (PREP1 hd ), PREP1 240-344 (PREP1 HD ) and two intermediate lengths (PREP1 257-344 - PREP1 hd-C - and PREP1 240-325 -PREP1 hd-N -), where respectively the N- or C-terminal extensions of the HD are omitted. Production of the proteins is described in the Materials and Methods section. PBC-A and PBC-B domains of PBX1 are those required for its dimerization with PREP1. TALE lies between helix 1 and helix 2 of the HD. MEIS-A and MEIS-B domains are PREP1 motifs required for heterodomerization with PBX1. Panel B: Consensus sequences for DNA binding by PREP1-PBX1: the very frequent decameric (PMH) and the less frequent octameric (PH) oligonucleotides , are both highlighted in red in the sequence. Control probes correspond to two sequences that do not contain any PBX1 orPREP1 binding site. Oligonucleotides used for FP were 5′ labelled with 6-carboxyfluorescein (6-FAM) (see the Materials and Methods).

Article Snippet: The DNA template of PREP1 HD in which the four residues K 231 , K 233 , K 234 , and K 235 were mutated to alanine was purchased from Genscript Corporation (Piscataway, NJ) and showed the following sequence: 5′CAGCTTCAGTTACAGTTAAACCAAGATCTCAGCATCTTGCATCAAGATGATGGTTCATCTAAGAACAAGAGGGGCGTCCTGCCAAAGCATGCCACGAACGTGATGCGGTCCTGGCTCTTCCAGCACATCGGGCATCCCTACCCAACAGAGGATGAGAAAAAACAGATTGCTGCTCAGACAAATTTGACACTACTCCAAGTCAACAACTGGTTCATCAATGCCAGAAGACGAATTCTTCAGCCAATGTTGGATTCAAGTTGTTCAGAGACCCCCGCAACAGCGGCAGCAACTGCTCAGAACCGGCCAGTTCAGAGG 3′.

Techniques: Construct, Comparison, Binding Assay, Sequencing, Control

Journal: Scientific Reports

Article Title: New Insights into Cooperative Binding of Homeodomain Transcription Factors PREP1 and PBX1 to DNA

doi: 10.1038/srep40665

Figure Lengend Snippet: K D values for individual HDs with different DNA sequences, measured by FP.

Article Snippet: The DNA template of PREP1 HD in which the four residues K 231 , K 233 , K 234 , and K 235 were mutated to alanine was purchased from Genscript Corporation (Piscataway, NJ) and showed the following sequence: 5′CAGCTTCAGTTACAGTTAAACCAAGATCTCAGCATCTTGCATCAAGATGATGGTTCATCTAAGAACAAGAGGGGCGTCCTGCCAAAGCATGCCACGAACGTGATGCGGTCCTGGCTCTTCCAGCACATCGGGCATCCCTACCCAACAGAGGATGAGAAAAAACAGATTGCTGCTCAGACAAATTTGACACTACTCCAAGTCAACAACTGGTTCATCAATGCCAGAAGACGAATTCTTCAGCCAATGTTGGATTCAAGTTGTTCAGAGACCCCCGCAACAGCGGCAGCAACTGCTCAGAACCGGCCAGTTCAGAGG 3′.

Techniques: Control

Journal: Scientific Reports

Article Title: New Insights into Cooperative Binding of Homeodomain Transcription Factors PREP1 and PBX1 to DNA

doi: 10.1038/srep40665

Figure Lengend Snippet: DNA probes were incubated with different amounts of HD. Protein:DNA ratios were 0.5 (DNA excess), 1 (equimolar ratio), or 2 (protein excess). Gels were stained both with ethidium bromide and coomassie blue to visualize DNA or proteins, respectively. Panel A: PREP1 HD forms two different complexes with PMH: the first is visible, at protein:DNA ratio of 0.5 (lanes 1 and 2, left panel), and the second as a smeared band, at protein:DNA ratio of 2 (lane 3, left panel). This slower migrating band might represent binding of two PREP1 HD proteins to DNA. In the case of PH (central panel) and control probes (right panel), a specific DNA complex is not formed. Panel B: PREP1 hd forms a single complex with PMH; whereas binding to control and PH oligos is weak and no specific bands are formed. Panel C: PBX1 HD forms a single complex with PMH and PH oligos at protein:DNA ratio of 0.5 (lane 1); by increasing the protein concentration, a slower migrating band becomes visible, possibly due to binding of a second monomer to DNA. PBX1 binds also the control oligo.

Article Snippet: The DNA template of PREP1 HD in which the four residues K 231 , K 233 , K 234 , and K 235 were mutated to alanine was purchased from Genscript Corporation (Piscataway, NJ) and showed the following sequence: 5′CAGCTTCAGTTACAGTTAAACCAAGATCTCAGCATCTTGCATCAAGATGATGGTTCATCTAAGAACAAGAGGGGCGTCCTGCCAAAGCATGCCACGAACGTGATGCGGTCCTGGCTCTTCCAGCACATCGGGCATCCCTACCCAACAGAGGATGAGAAAAAACAGATTGCTGCTCAGACAAATTTGACACTACTCCAAGTCAACAACTGGTTCATCAATGCCAGAAGACGAATTCTTCAGCCAATGTTGGATTCAAGTTGTTCAGAGACCCCCGCAACAGCGGCAGCAACTGCTCAGAACCGGCCAGTTCAGAGG 3′.

Techniques: Incubation, Staining, Binding Assay, Control, Protein Concentration

Journal: Scientific Reports

Article Title: New Insights into Cooperative Binding of Homeodomain Transcription Factors PREP1 and PBX1 to DNA

doi: 10.1038/srep40665

Figure Lengend Snippet: FP K D measurement of PREP1 HDs in the presence of a preformed PBX1 HD : DNA complex.

Article Snippet: The DNA template of PREP1 HD in which the four residues K 231 , K 233 , K 234 , and K 235 were mutated to alanine was purchased from Genscript Corporation (Piscataway, NJ) and showed the following sequence: 5′CAGCTTCAGTTACAGTTAAACCAAGATCTCAGCATCTTGCATCAAGATGATGGTTCATCTAAGAACAAGAGGGGCGTCCTGCCAAAGCATGCCACGAACGTGATGCGGTCCTGGCTCTTCCAGCACATCGGGCATCCCTACCCAACAGAGGATGAGAAAAAACAGATTGCTGCTCAGACAAATTTGACACTACTCCAAGTCAACAACTGGTTCATCAATGCCAGAAGACGAATTCTTCAGCCAATGTTGGATTCAAGTTGTTCAGAGACCCCCGCAACAGCGGCAGCAACTGCTCAGAACCGGCCAGTTCAGAGG 3′.

Techniques:

Journal: Scientific Reports

Article Title: New Insights into Cooperative Binding of Homeodomain Transcription Factors PREP1 and PBX1 to DNA

doi: 10.1038/srep40665

Figure Lengend Snippet: Panel A: A sample containing a preformed PBX1 HD :PMH complex (at 4 and 8 μM, respectively) was titrated with increasing amounts of PREP1 HD (2, 4 and 8 μM). PREP1 HD binds preferentially to the PBX1 HD :PMH complex rather than to the free DNA; the DNA pool decrease appreciably upon an increase in PREP1 HD concentration. At the lower PREP1 HD concentrations (lane 3) a slower migrating band is observed above the monomeric PREP1 HD :DNA and PBX1 HD :DNA complexes (identified in lanes 1 and 2, respectively). The band marked with a star in lane 5 was analyzed by mass spectrometry. Panel B: Titration of PREP1 HD : PMH complex with PBX1 HD . PREP1 HD (4 μM) and PMH (4 μM) were titrated with increasing concentrations of PBX1 hHD (2, 4 and 8 μM). Upon increase of PBX1 HD a slower migrating band appears, corresponding to PREP1 HD :DNA:PBX1 HD complex. Panel C: Titration of PBX1 HD : PMH complex with PREP1 hd . PBX1 HD (4 μM) and PMH (4 μM) were titrated with increasing concentrations of PREP1 hd (2, 4 and 8 μM). Upon increase of PREP1 hd only a band corresponding to PREP1 hd :DNA is visible, therefore, PREP1 hd in EMSA does not show clear binding to the preformed PBX1 HD :DNA complex. Panel D: Titration of PMH:PBX1 HD with PREP1 hd-N . PMH and PBX1 HD at a fixed concentration (8 μM and 4 μM, respectively) were titrated with increasing amounts of PREP1 hd-N (2, 4, 8, and 16 μM). Upon an increase in PREP1 hd-N no retarded band above the individual PMH:PREP1 hd-N and PMH:PBX11 HD complexes (lanes 3-5) are observed Panel E: Titration of PBX1 HD :PMH with PREP1 hd-C . PMH oligo and PBX1 HD at a fixed concentration (8 μM and 4 μM, respectively) were titrated with increasing concentrations of PREP1 hd-C (2, 4 and 8 μM). Upon an increase in PREP1 hd - C , a slower migrating band corresponding to PREP1 hd-C :DNA: PBX1 HD complex is visible.

Article Snippet: The DNA template of PREP1 HD in which the four residues K 231 , K 233 , K 234 , and K 235 were mutated to alanine was purchased from Genscript Corporation (Piscataway, NJ) and showed the following sequence: 5′CAGCTTCAGTTACAGTTAAACCAAGATCTCAGCATCTTGCATCAAGATGATGGTTCATCTAAGAACAAGAGGGGCGTCCTGCCAAAGCATGCCACGAACGTGATGCGGTCCTGGCTCTTCCAGCACATCGGGCATCCCTACCCAACAGAGGATGAGAAAAAACAGATTGCTGCTCAGACAAATTTGACACTACTCCAAGTCAACAACTGGTTCATCAATGCCAGAAGACGAATTCTTCAGCCAATGTTGGATTCAAGTTGTTCAGAGACCCCCGCAACAGCGGCAGCAACTGCTCAGAACCGGCCAGTTCAGAGG 3′.

Techniques: Concentration Assay, Mass Spectrometry, Titration, Binding Assay

Journal: Scientific Reports

Article Title: New Insights into Cooperative Binding of Homeodomain Transcription Factors PREP1 and PBX1 to DNA

doi: 10.1038/srep40665

Figure Lengend Snippet: Mass spectrometry analysis of EMSA titrations bands from Fig. 3 .

Article Snippet: The DNA template of PREP1 HD in which the four residues K 231 , K 233 , K 234 , and K 235 were mutated to alanine was purchased from Genscript Corporation (Piscataway, NJ) and showed the following sequence: 5′CAGCTTCAGTTACAGTTAAACCAAGATCTCAGCATCTTGCATCAAGATGATGGTTCATCTAAGAACAAGAGGGGCGTCCTGCCAAAGCATGCCACGAACGTGATGCGGTCCTGGCTCTTCCAGCACATCGGGCATCCCTACCCAACAGAGGATGAGAAAAAACAGATTGCTGCTCAGACAAATTTGACACTACTCCAAGTCAACAACTGGTTCATCAATGCCAGAAGACGAATTCTTCAGCCAATGTTGGATTCAAGTTGTTCAGAGACCCCCGCAACAGCGGCAGCAACTGCTCAGAACCGGCCAGTTCAGAGG 3′.

Techniques: Mass Spectrometry

Journal: Scientific Reports

Article Title: New Insights into Cooperative Binding of Homeodomain Transcription Factors PREP1 and PBX1 to DNA

doi: 10.1038/srep40665

Figure Lengend Snippet: Panel A: Superposition of 1 H- 15 N HSQC spectra of PREP1 HD (magenta) and PREP1 hd (blue). Panel B: Combined amide chemical shift difference (Δ δ ) between PREP1 HD and PREP1 hd corresponding residues. Panel C: Cartoon representation of the PREP1 HD model: the residues (in blue) shared with PREP1 hd , the N- and C- terminal extensions (in cyan) of PREP1 HD . Spheres indicate PREP1 HD residues showing significant (>average) amide Δ δ with respect to PREP1 hd . Panel D: Normalized CD melting curves for PREP1 HD (magenta) and PREP1 hd (blue) at 222 nm.

Article Snippet: The DNA template of PREP1 HD in which the four residues K 231 , K 233 , K 234 , and K 235 were mutated to alanine was purchased from Genscript Corporation (Piscataway, NJ) and showed the following sequence: 5′CAGCTTCAGTTACAGTTAAACCAAGATCTCAGCATCTTGCATCAAGATGATGGTTCATCTAAGAACAAGAGGGGCGTCCTGCCAAAGCATGCCACGAACGTGATGCGGTCCTGGCTCTTCCAGCACATCGGGCATCCCTACCCAACAGAGGATGAGAAAAAACAGATTGCTGCTCAGACAAATTTGACACTACTCCAAGTCAACAACTGGTTCATCAATGCCAGAAGACGAATTCTTCAGCCAATGTTGGATTCAAGTTGTTCAGAGACCCCCGCAACAGCGGCAGCAACTGCTCAGAACCGGCCAGTTCAGAGG 3′.

Techniques:

Journal: Scientific Reports

Article Title: New Insights into Cooperative Binding of Homeodomain Transcription Factors PREP1 and PBX1 to DNA

doi: 10.1038/srep40665

Figure Lengend Snippet: Data reported correspond to a protein:PMH molar ratio of 1:0.5. Panel A: Superposition of 1 H- 15 N HSQC spectra of free (black) and PMH-bound (red) PREP1 HD . (left) and PREP1 hd (right) Panel B: Plot showing the peaks intensity reduction observed upon PMH binding to PREP1 hd and PREP1 HD . Panel C: Residues disappearing or showing significant amide chemical shift displacement (as reported in the CSD plot in ) are highlighted on PREP1 HD structural model (top, generated using CS23D2.0 web server) and PREP1 hd NMR structure (bottom, 1 × 2 N.pdb,).

Article Snippet: The DNA template of PREP1 HD in which the four residues K 231 , K 233 , K 234 , and K 235 were mutated to alanine was purchased from Genscript Corporation (Piscataway, NJ) and showed the following sequence: 5′CAGCTTCAGTTACAGTTAAACCAAGATCTCAGCATCTTGCATCAAGATGATGGTTCATCTAAGAACAAGAGGGGCGTCCTGCCAAAGCATGCCACGAACGTGATGCGGTCCTGGCTCTTCCAGCACATCGGGCATCCCTACCCAACAGAGGATGAGAAAAAACAGATTGCTGCTCAGACAAATTTGACACTACTCCAAGTCAACAACTGGTTCATCAATGCCAGAAGACGAATTCTTCAGCCAATGTTGGATTCAAGTTGTTCAGAGACCCCCGCAACAGCGGCAGCAACTGCTCAGAACCGGCCAGTTCAGAGG 3′.

Techniques: Binding Assay, Generated